EST details — SGN-T102357

Search information 
Request: TMEAA34THBMatch: SGN-T102357
Request From: web userMatch Type: Chromatogram internal Identifier
Clone information 
SGN ID: SGN-C82217Clone name: cLET-1-E19
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C179423 is on microarray TOM1: SGN-S1-1-4.4.2.13
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C82217 [cLET-1-E19] Trace: SGN-T102561 EST: SGN-E292287 Direction: 3' Facility: TIGR
Clone: SGN-C179423 [TUS-31-L13] Trace: SGN-T185502 EST: SGN-E373364 Direction: 3' Facility: INRA
Clone: SGN-C179423 [TUS-31-L13] Trace: SGN-T185503 EST: SGN-E373365 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E292083Length: 657 bp (856 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E292083 [] (trimmed) TTTTGAGCTTTGGTGCTTTCAAATTGACAAAGTACCAACCTTTATTCTCAATTTTCAACAAGGCAAAAGTTTGCTTCAAGAAAATTTTAAAAAAA
AACAATCAATGGCGACTGCTTCTTCTTTGGGTTCATCAACTCTGTTACAATCCCAAATTAGTGGATTTGGCGGGAGTCAAAAGATTTCTTTCTCC
AACCCCAATTCACTCACTTTCACCAGGAGGAGAATTCAAACTGTGGTGACAGCTTCTTCTCGGGTGGATAAGTTCTCGAAAAGCGACATTATTGT
TTCTCCATCCATCCTTTCTGCTAACTTTTCTAAATTAGGAGAGCAGGTGAAAGCAGTTGAGCAGGCAGGCTGCGACTGGATTCATGTAGATGTGA
TGGATGGTCGATTTGTTCCAAATATAACTATTGGACCCCTTGTAGTTGATTCCTTGCGCCCTATCACAGATCTTCCACTGGATGTGCATCTGATG
ATTGTCGAACCTGACCAGAGAGTACCTGACTTCATAAAAGCAGGTGCTGATATTGTCAGTGTTCATTGTGAGCAATCTTCTACAATCCACTTGCA
TCGTACAATAAACCAGATTAAAAGTTTGGGAGCTAAAGCTGGGGTTGTCCTCAATCCTGGAACCCCTTTAACCGCAATTGAATATGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E292083] SGN-U580678 Tomato 200607 Build 2 131 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T102357 [Download] [View] Facility Assigned ID: TMEAA34THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.973 Expected Error Rate: 0.0045 Quality Trim Threshold: 14.5