EST details — SGN-T102418

Search information 
Request: TMEAA88TVMatch: SGN-T102418
Request From: web userMatch Type: Chromatogram internal Identifier
Clone information 
SGN ID: SGN-C82442Clone name: cLET-1-O7
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C179583 is on microarray TOM1: SGN-S1-1-4.3.1.10
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C82442 [cLET-1-O7] Trace: SGN-T102417 EST: SGN-E292143 Direction: 5' Facility: TIGR
Clone: SGN-C179583 [TUS-32-C5] Trace: SGN-T185804 EST: SGN-E373141 Direction: 3' Facility: INRA
Clone: SGN-C179583 [TUS-32-C5] Trace: SGN-T185805 EST: SGN-E373142 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E292144Length: 487 bp (559 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E292144 [] (trimmed) ACGCAAAATTATATATTACAAAAATATCATAATAATTAAAAAAAAACACAACAATTAATTATTTATACAGCTAGTTGAATATCCCCAATTTCAAG
CTGTGCAGCAATATCTTCAAGTTGTTTCTTCACACTCATATCAATCAATTTAGATCCTGAATTTCCATACCTTATTGTAAATCCAGCAACAAGAG
ATTCATCAATCACTGTTTTGATCCTCACATTTTTCGCTCCTGTTAATCGTTGAACTCCTTTTGCGATCTGTGCTAAATGTTGCGATTCCAGTTTC
ACCACTGAAGTCACTACAGCAAGTTCAGTATCCGTCAAGGTATTGTAAACTTTCTCAAACTCTTTAACAATGTCTTTGATTAATTCAACTCTCTT
CATATCAACAAGGATGTTGAGAAAATTTGCAACGTGTGGTTGAATGCCTGTAGATGAAACGATCTCGTCGACGAGTTCACGTTTTTTCTCTTCGC
TAACGATAGGAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E292144] SGN-U583491 Tomato 200607 Build 2 82 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T102418 [Download] [View] Facility Assigned ID: TMEAA88TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.922 Expected Error Rate: 0.0005 Quality Trim Threshold: 14.5