EST details — SGN-T102448

Search information 
Request: TMEAB78THMatch: SGN-T102448
Request From: web userMatch Type: Chromatogram internal Identifier
Clone information 
SGN ID: SGN-C82381Clone name: cLET-1-M12
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C179543 is on microarray TOM1: SGN-S1-1-4.1.1.14
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E292174Length: 608 bp (934 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E292174 [] (trimmed) GCAACGTGGAGAGATTAGAGCAAGTATACAATTTTGTGGTTGTTAAACATTTACACCACATTTTACCCCTACAACCAAAAAAGAAGAATTGTGTG
CTCTTTACTCTCCAATGGCTACTCCATTGGCGCCTCTTCATGGATTCAATTCACCAGCAATTCCATTAAACAAGCAAACCCAGCTCCCTATTCTT
ATGAAACGGAACAAGCAATTAAGCAAGCCAATCAACGCCGTTGCGGCCACCGATATAATTACTTCAGATCCAACTCAGGTGGAAATCACTTGGCA
AATTGTTGCTGGATCTTTGGCGGGTGTGACACCATTTGTGGTAGCAAGAGTCGAGTTCAGCAAACGAATTGGTAAAACAGAGGAAATGTGAAGTT
TGTGGGGGTTCAAGACTTGTTCTTAAGAACAAATTTTATAAGAGATGTGCTAATTGTGGGGGATTTCTTCCTTGGCAGGCTCGGAGAAGATTCTT
CACTGGCTAATAAATAGTAGTTCATTTGTGGAAGCTTCATACCAAGTTTGATGATTGACTCTATACATCCAATATACATATGTATACTACTTGTA
AAACATAAGATTTCGATACAAGTCTTCATGTATACCAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E292174] SGN-U564703 Tomato 200607 Build 2 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T102448 [Download] [View] Facility Assigned ID: TMEAB78TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.967 Expected Error Rate: 0.0194 Quality Trim Threshold: 12.5