EST details — SGN-T102808

Search information 
Request: TMEAE05THMatch: SGN-T102808
Request From: web userMatch Type: Chromatogram internal Identifier
Clone information 
SGN ID: SGN-C84716Clone name: cLET-2-A9
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C181913 is on microarray TOM1: SGN-S1-1-2.4.10.7
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C181913 [TUS-38-D7] Trace: SGN-T194439 EST: SGN-E393113 Direction: 5' Facility: INRA
Clone: SGN-C181913 [TUS-38-D7] Trace: SGN-T194689 EST: SGN-E393363 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E291267Length: 581 bp (907 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E291267 [] (trimmed) CTGGCATTGCAGACAGCACAGATGAGGTGAAGAATTTGCATGATTCTAGTGTGGACAAGGCTGCAGAATTGGCAGCAGGATTTACAAATGTTTTG
GTTGGACTAGCTCCTAATGACATGGTTCAAAGGACTGCTCGAAGACTGGATACTCTTCATTCAGAGGGTGTTCATAGACTTTCAGAGTTGTGTTG
TTTTGCTGCGACTCAACTTGTAATGCTTGGGAAATCAATCATTTCAACTGCAAATAAAGTTGGGGACCAAGATGCAAATGTGGAAATTCTGAAAA
TGGAATGGCCGGAGGATTCAATTGAAAGAGCTAAGGTAATCCGATCAAAGGCATGTTCAATGACTCGATGTGTTGAAACAGTTTCTTCCAGCTTC
ATTACAGGGATATCTGAAGTGTCTGAAGCGTATTTAGCAGCAGTGAAGAGTGTATCTGCTGATTCACATGAGGTTCCACAGAAATCAATCCAGGA
GAAGGCCAATGCATATGCTGAGAATCTTCGTGCTGCTCATAGCACAGCCATGGGCAAAATTCAGGACGGCCTTCAATATTTACCCTATGTGGTCA
TCTCAACCTCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E291267] SGN-U566278 Tomato 200607 Build 2 31 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T102808 [Download] [View] Facility Assigned ID: TMEAE05TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.950 Expected Error Rate: 0.0060 Quality Trim Threshold: 14.5