EST details — SGN-T102824

Search information 
Request: TMEAE36THMatch: SGN-T102824
Request From: web userMatch Type: Chromatogram internal Identifier
Clone information 
SGN ID: SGN-C84787Clone name: cLET-2-E23
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C190624 [TUS-60-O6] Trace: SGN-T341427 EST: SGN-E540552 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C190624 [TUS-60-O6] Trace: SGN-T349279 EST: SGN-E548404 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E291283Length: 631 bp (908 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E291283 [] (trimmed) TTCCACTCTCCTCTGCCAAATTTCACACTTCAATTCTCACACAATCACTCCCCTCTTCTTCCTCTCGTTCTTTTTCCGTCGGAAAACGCTTCTGT
TGCTCGTCGTCATCAACTTCCATGGAACATCATGAATCGAAATTTAAGGAATTTCCTTATGCATCTGTTCCGCATAGAGAGTTAATGGTGGAACT
TGTATCGACTGTGGAGAATCGTCTTGGAGAGTCTCTACTTCCTTGTACTCTGCCTTCTCATGTGCAGTATTTTGAGAATGAATCTGCTACTGCTC
ATGCTTCTCTCTATGTCAGATCTGGAAATTCCTCTTCTCAGGTTGATTTCATACTTGGTAGTTGGGTTCACTGCAACTTACCCACCGGCGGAGCA
TTGAATATTACAAGCCTTTCCGTATATTTGAGACCTTCAACTGATGCACCAAACTTCTTAATTGAAGTTATTCAAAGCAGTCCAACAACTCTCAT
CCTCATTCTTGATCTACCTCCGCGAAAGGACCTTGTCCAACATCCCGATTACCTCAAGACCTTTTATGAGGAAACACAATTAGATAAGCAGAGAC
AACTTCTCGAGAAGCTACCTGAGGTAAAGCCTTATTTCTCTTCTTCTCTATATATTCGAGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E291283] SGN-U582628 Tomato 200607 Build 2 18 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T102824 [Download] [View] Facility Assigned ID: TMEAE36TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.962 Expected Error Rate: 0.0085 Quality Trim Threshold: 14.5