EST details — SGN-T103220

Search information 
Request: TMEAL17THMatch: SGN-T103220
Request From: web userMatch Type: Chromatogram internal Identifier
Clone information 
SGN ID: SGN-C85541Clone name: cLET-3-D10
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E289549Length: 220 bp (792 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E289549 [] (trimmed) GGCAATAGAGTTTGATTATATAGTTAACAAGTTATCATAATGGCTAGCTTGAACACTTTAGCCATTGTTGCTTTTGCACTTGCTTTCTTCGTACA
AGTCACTTTAGGGGATATTGCGTGCGAGAATTTGAATGAAGACTCTTGTGCATTTGCAATATCAAGCACGGGTAAGCGTTGTGTTTTAGAGAAAC
ATGTTCGTAGGAGTGGTGAAGAAGTATATA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E289549] SGN-U569163 Tomato 200607 Build 2 8 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T103220 [Download] [View] Facility Assigned ID: TMEAL17TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.925 Expected Error Rate: 0.0119 Quality Trim Threshold: 14.5