Notice: Please give us important feedback on the future of SGN using this survey: https://www.surveymonkey.com/r/VJTRHVC

EST details — SGN-T103768

Search information 
Request: TMEAU44THMatch: SGN-T103768
Request From: web userMatch Type: Chromatogram internal Identifier
Clone information 
SGN ID: SGN-C87933Clone name: cLET-6-G15
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E291515Length: 523 bp (1012 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E291515 [] (trimmed) GTCATTTCTAAGTAGCAGAAAAATGGCTCCAATCGCCGGTGGTGACGTCATCCCCGATGGTACCGTATCTTACTTCGACGAGCAAGATCAGATGC
AGACCGTCTCAGTATACTCACTTGCTAAGGGCAAGAAGGTCATCATCTTCGCCGTTCCCGGAGCTTTCACTCCCACTTGCAGCATGAAGCATGTG
CCTGGCTTTATTGAAAAGGCTGCTGAGTTGAAGTCAAAGGGTGTCGATGAAATCCTCTGCATCAGTGTCAATGACCCCTTTGTGATGAAGGCCTG
GGCAAAAACTTACCCTGAGAACAAACATGTAAAATTTCTTGCTGATGGAGCTGGAAAATACACCCATGCCCTTGGGCTGGAGCTTGATCTGTCGG
ATAAGGGGCTTGGTGTTCGATCACGAAGGTATGCTCTTTTGGTTGATGACCTTGAGGTGAAAGTAGCTAACATTGAATCTGGAGGGGAGTTCACG
GTCTCTCGTGCTGATGAAATCGGCAATGCTCTTTAAGCTTATCACTAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E291515] SGN-U579086 Tomato 200607 Build 2 92 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T103768 [Download] [View] Facility Assigned ID: TMEAU44TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.985 Expected Error Rate: 0.0112 Quality Trim Threshold: 12.5