Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

Due to a hardware issue, SGN was briefly unavailable earlier today. We apologize for any inconvenience.

EST details — SGN-T104083

Search information 
Request: TMEAZ44THMatch: SGN-T104083
Request From: web userMatch Type: Chromatogram internal Identifier
Clone information 
SGN ID: SGN-C88208Clone name: cLET-7-G16
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E291830Length: 678 bp (858 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E291830 [] (trimmed) TGGTTGTGGACAGTAAGATCAATTCAGACCACATCGAAATGTATGCGGAACGGACAGCCAGGGGAAATGTCCTTGAGCCGGAAGGTATGATTGAA
ATTAGATTCAGAACAAAAGAACAGCTCGAGTGCATGGGTAGGACTGACCAACAGCTTATCAATCTCAAGTCAAAGCTTCAGGAAGCCAAGACCGC
AGGGGTATACGCTAATGTTGATGCCCTAGTGAAGCAAATTAAAACCCGTGAGACACAGCTTTTGCCCGTATACACGCAGATAGCTACAAAGTTTG
CAGAGTTACATGATACTTCGTCAAGAATGGCGTCCACGGGGGTGATCCGTAAAATAGTAGATTGGGAAACTTCTCGTTCATTCTTTTACGGACGT
CTGCTTCGAAGAGTAGAGGAGGAAATGTTGGTCAAAACTGTGAGGAATGCTGCTGGTGACCAGCTTTCTTATAAATCTGCTATGGGTATGGTGAA
AAGCTGGTTTTTGGATTCAAAACAAGGCAATGTAGATGCTTGGATCGATGATGAAGCCTTTTTCTCATGGAAGAATGACCCCAAGAACTATGAAG
AACAACTACAAGAATTGCGGGTGCAAAAGGTACTACTTCAGCTATCGAAGATTGGTGATTCGACATTGGATTTACATGCCCTACCACAAGGTCTT
CTTTCCCTCCTAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E291830] SGN-U584791 Tomato 200607 Build 2 13 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T104083 [Download] [View] Facility Assigned ID: TMEAZ44TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.980 Expected Error Rate: 0.0047 Quality Trim Threshold: 14.5