Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-T104267

Search information 
Request: TMEBA53THMatch: SGN-T104267
Request From: web userMatch Type: Chromatogram internal Identifier
Clone information 
SGN ID: SGN-C88270Clone name: cLET-7-J9
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C186401 is on microarray TOM1: SGN-S1-1-2.3.5.13
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E292014Length: 455 bp (875 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E292014 [] (trimmed) GAAATCTGTGCATCTGTGGTTGAGGAGAGCTTTGAGTATCTTGATGCACCAGTTGAGAGGATATCAGGTGCTGATGTTCCTATGCCATACGCTGC
TAATCTTGAAAGACTGGCTGTTCCACAGGTAGAGGACATCGTTCGTGCAGTCAAGAGGGTTTGTTACCGATCAAGTAAATAGATCATTTCCAATG
GCTGCAGCTGCTTAGGCTTGGTCCAGCGATGCCTTGATTGTTCCAAAGCATTTAACTTCTATTTGTGGATATCAATTCTTTATCCGCCTATAAGC
GTATGCTTTCAGCCATCTTCTGGGAAGTTCAATTGACTGTAAAACCAGCCAAACTGGTAAACTAACGAATGAAATCTGCTGCCAGATTTTTCGGC
CACGCAAGGAAATAGTTCTTGTAGAAAATAATACTTAACAGCTTTTTTCCCTTAAAGAAAATGTTGTTACAAGAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E292014] SGN-U578825 Tomato 200607 Build 2 52 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T104267 [Download] [View] Facility Assigned ID: TMEBA53TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: Multiple cloning site sequence detected -- chimeric clone suspected.
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: 0