Notice: The SGN server upgrade is complete. Please let us know if you find any issues. :-)

EST details — SGN-T104114

Search information 
Request: TMEBA54THMatch: SGN-T104114
Request From: web userMatch Type: Chromatogram internal Identifier
Clone information 
SGN ID: SGN-C88254Clone name: cLET-7-J11
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E291861Length: 532 bp (894 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E291861 [] (trimmed) GCCATGGCCAACATGATGATGAGCTCCTCCAAAGTTTTAATCACTTCTTCATCCTCCACCATCCCTCCATCACCAAGATTCAAACTTTCCCTCAC
CCAAATCCCTTTTCCAAAACTACCCCTCCCCAAATCACCCAAATCCCTTGAAACCCTTTCAATCCCATCAACTCTCAAGTCCATTTCTGTCATTC
TTGCAAGCTCATTGGCCATGGCACCACCTTCGCTAGCAGAGGAAATTGAAAAAGCTTCCCTTTGTGACTTCAACTTGACACTCCCAATCATGATG
GCTGAATTCCTCTTTCTCATGTTAGCTTTAGACAAGATTTACTTCAGCCCATTAGGGAAATTCATGGATGAAAGAGATTCTGCCATTAAGGAGAA
ATTGAGCAGTGTGAAGGACACCTCTGCTGAAGTGAAGCAACTGGAAGACCAGGCTGCTGCAATTATGAAGGCTGCAAGGGCTGAGATATCAGCAG
CATTGAACAAGATGAAGAAAGAGACTCAGCAAGAAGTAGAGCAGAAGATTGCAGAAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E291861] SGN-U579241 Tomato 200607 Build 2 63 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T104114 [Download] [View] Facility Assigned ID: TMEBA54TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.953 Expected Error Rate: 0.0063 Quality Trim Threshold: 14.5