EST details — SGN-T104121

Search information 
Request: TMEBA69THMatch: SGN-T104121
Request From: web userMatch Type: Chromatogram internal Identifier
Clone information 
SGN ID: SGN-C88295Clone name: cLET-7-L17
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C190751 [TUS-61-D13] Trace: SGN-T341645 EST: SGN-E540770 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C190751 [TUS-61-D13] Trace: SGN-T349315 EST: SGN-E548440 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E291868Length: 675 bp (888 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E291868 [] (trimmed) GTTTGTTTCTGTTCCTTGTTTCCAAATTATGCAATGGTTACTCAACAAAGTTGAATTTCTATCCTCCAACTTGTCAAAGAATTGAATGCCCAAAT
TATGATTTGATTGAATCTGGAAAAGACTATGAAATTCGTCGTTACGATTCCCCTATGTGGATGTCTACTGCTCCTATTGATGATATTTCATATGT
TTCCGCCACCAGAACTGGTTTCCTCAGGCTATTTGATTACATTCAAGGGAAGAATAAGTACCATGAGACAGTAAAGATGACAGCTCCAGTTATCA
TTCAAGTGAAGCCAAGTGATGGACCTTTTTGTGCTTCTTCATTTGTTGTGAGTTTTTATGTACCAAAGAAGAACCAGCCAAATCCTCCTCCAGCT
AAAGGCCTTCATCTCCAGAAATGGGGGGACACTTACGTCGCGGTCAGGCAATTCAGTGGATTTATAGCTGATGATGACCTTCCAAGAGAAGCCGC
TGCCCTGAGTGCCAGTATTGCTGGCACTAATTGGGCAGCAGCCATCGACAAAAGCCATGCTGCAGACAATACAACGTTGTATACAGTGGCGGGAT
ACAACTCCCCATTTGAGTTCAAGAACAGAGTTAATGAGATATGGTTTACTTTTGATTTGGAAAAAGCACTTGCCATTTGAAAAGCTGCTTTTGTT
ACTACTTATC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E291868] SGN-U584870 Tomato 200607 Build 2 13 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T104121 [Download] [View] Facility Assigned ID: TMEBA69TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.973 Expected Error Rate: 0.0031 Quality Trim Threshold: 14.5