EST details — SGN-T104303

Search information 
Request: TMEBC18THMatch: SGN-T104303
Request From: web userMatch Type: Chromatogram internal Identifier
Clone information 
SGN ID: SGN-C88408Clone name: cLET-8-C11
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C186403 is on microarray TOM1: SGN-S1-1-8.3.5.17
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E290907Length: 599 bp (933 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E290907 [] (trimmed) CAATGGCAAGTGAGAAAGTGAAATTGCTTGGATACTGGGCAAGCCCTTTTGCTCTGAAGGTTCATTGGGCACTGAAACTGAAAGGTATTGAATAT
GAATACCAAGAAGAAGATCTCTCAAACAAAAGTCCTTTGCTCTTGCAGTACAATCCAGTTCATAAGAAGATTCCGGTTTTGGTTCATAATGGGAA
ACCTATTGCAGAATCACTAGTCATACTTGAATACATTGAAGAGACATGGAAGCACAATCCACTCCTCCCTGAAGATCCTTATGAAAGAGCCAAGG
CGCGTTTTTGGGCAAAATTTGTTGATGACAAGTGTGTGCCAGGAATATTTGGTACCTTTGCCAAGGTCGGAGTGGAGCAACAGAAGATAGCAAAA
GAAGCTCGTGAGAACTTGAAAATTTTAGAGGATGAACTAGGCAAGAAGCACTTTTTTGGAGAGGCAAAAATTGGCTTCATGGATGTCACGTCTGC
TTGGATCATCTGCTGGGCTCAGATTGTTGAGGAGGTTGTGGATATCAGACTTATTGATGCCGAGGAAATGCCTTCACTTGTTTCATGGTTTCAGA
ATGTCCTTGAAGCTGCTCCCATTTCTGAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E290907] SGN-U575771 Tomato 200607 Build 2 10 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T104303 [Download] [View] Facility Assigned ID: TMEBC18TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.962 Expected Error Rate: 0.0078 Quality Trim Threshold: 14.5