EST details — SGN-T107679

Search information 
Request: TMEDA10THMatch: SGN-T107679
Request From: web userMatch Type: Chromatogram internal Identifier
Clone information 
SGN ID: SGN-C82482Clone name: cLET-20-B19
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E295265Length: 594 bp (964 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E295265 [] (trimmed) CTCATACTTCCTCTCAAAACACCAAATCGGAAAAAAACCATGGCCGGAGTTGAATTCCTCCCCAAAGAATATGGATATGTAATTCTTGCTCTTGT
CGTCTACTGTTTCTTCAACTTCTGGATGTCCTTTCAAGTCGGCAAAGCCCGCAAACAGTACAAGGTTCCTTATCCAACAATGTATGCTACTGAAG
CTGAAAACAAGAATGCTAATTCCTTTAACTGTGTTCAGAGAGGTCATCAGAATTCATTAGAAATGATGCCAACATTTTTCATGCTGATGATTGTT
GGAGGAATTAGGCACCCCTTGATTTGTGCATCTCTTGGAGCTGTTTATATTGTATCTCGCTATTTCTACTTCACTGGTTATTCCACTGGCGATCC
CCAAAATCGGCTTACTCTTGGGAAATACAATTTCTTGGCAATTATGGCACTGATGATTTGCGCAGCATCTTGTGGAGTTAATTTTCTTATGTCAT
GAATATTAGTCTCAAATAGAGTAACCTCCTTGTAATTCCCTTTATTTCCAGTAAGAAATGATGTCTTTTTTATGTCTGTTTTGTCATTAATATGA
ATTGAATTGGTACTTTCTGTATCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E295265] SGN-U580456 Tomato 200607 Build 2 25 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T107679 [Download] [View] Facility Assigned ID: TMEDA10TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.955 Expected Error Rate: 0.0038 Quality Trim Threshold: 12.5