EST details — SGN-T107727

Search information 
Request: TMEDB35THMatch: SGN-T107727
Request From: web userMatch Type: Chromatogram internal Identifier
Clone information 
SGN ID: SGN-C82543Clone name: cLET-20-F22
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C184751 is on microarray TOM1: SGN-S1-1-4.2.14.13
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C184751 [TUS-45-J13] Trace: SGN-T198714 EST: SGN-E397388 Direction: 3' Facility: INRA
Clone: SGN-C184751 [TUS-45-J13] Trace: SGN-T198715 EST: SGN-E397389 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E295313Length: 457 bp (965 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E295313 [] (trimmed) TTTCCTCCAATTTGTACATTAAATATCTAAGAACAAACTAAGCCATGGGTGGAGGCAATGGACAGAAGGCAAAGATGGCTCGTGAGAAGAATATG
GAAAAGATGAAAGGCCAAAAGGGAAGCCAGCTTGAGGCTAACAAGAAGGCTATGAATATCCAGTGCAAGGTGTGCATGCAGACATTCATTTGCAC
CACTTCTGAAGTCAAGTGCAGAGAACATGCTGAGGCGAAGCATCCCAAATCTGATGTCTATGCATGTTTCCCTCATCTCAAGAAATGATTCACAT
TTCACAGTCTGGGCTGATGGTTGTTTCCCAACTATGTTTCGGGATTCTGTTAACCATGATAAAGTTTGAATCTGTTCAAAAGTTGTTGCTCCGTT
CTGCTTCAAACTGTTGATGGCACTTAGTTTGGAACTGTGTGAAATATATGTCTATAATAACTGCCTCCTTTTGGATT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E295313] SGN-U577263 Tomato 200607 Build 2 36 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T107727 [Download] [View] Facility Assigned ID: TMEDB35TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.960 Expected Error Rate: 0.0130 Quality Trim Threshold: 12.5