Notice: Please give us important feedback on the future of SGN using this survey: https://www.surveymonkey.com/r/VJTRHVC

EST details — SGN-T107742

Search information 
Request: TMEDB61THMatch: SGN-T107742
Request From: web userMatch Type: Chromatogram internal Identifier
Clone information 
SGN ID: SGN-C82636Clone name: cLET-20-L2
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C181916 is on microarray TOM1: SGN-S1-1-7.4.10.11
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C181916 [TUS-38-D10] Trace: SGN-T187698 EST: SGN-E374428 Direction: 3' Facility: INRA
Clone: SGN-C181916 [TUS-38-D10] Trace: SGN-T187699 EST: SGN-E374429 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E295328Length: 579 bp (928 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E295328 [] (trimmed) TTAGTGCTCTGGATTTCCCTGCTCTTTCTGTGGCAGAAAGTCAAAACAGCAGCCTAAAGTACTCTGGCAGTGATGCTCAACAAAATGTCAATCCC
TATAGGCCTTCTGAAAAAGAGAGCACCCTTCTTTTTAGATCTGGCTCTTCCATCCCTTTTCGAGGTGCTACAGATTTTGCATCTGCTGTCAGGAA
GATGGCATCTCAGGATTCTAGCATATGGAAGTATGATAGGACTGGAGTAGCTGATGGTAGTGTTGGATCAAGTAGAAATTCACCTGTATTGGCTA
GCTCTTACAATGGTGGACAGAGTAGGGGAGTTTATGGTGATAGGTTGCAGAGCCGAGGTTCCACACGTGCAGCTCCTGTCTGGCTTGAAACTGGA
GAAGCAGTTGCAAATATATATTCTGAAATGCGGGAAGAGGCTCGTGACCATGCACGCTTGCGTAATGCATACTTTGAACAGGCACGTCAGGCATA
TCTTATTGGTAACAAGGCTTTGGCCAAAGAACTGAGCGTCAAGGGACAACTTCACAATATGCAGATGAAGGCAGCTCATGGGAAGGCTCAAGAAT
CTATATATC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E295328] SGN-U574051 Tomato 200607 Build 2 37 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T107742 [Download] [View] Facility Assigned ID: TMEDB61TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.974 Expected Error Rate: 0.0064 Quality Trim Threshold: 14.5