EST details — SGN-T50453

Search information 
Request: TOVBB82THMatch: SGN-T50453
Request From: web userMatch Type: Chromatogram internal Identifier
Clone information 
SGN ID: SGN-C24321Clone name: cLED-7-N20
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C184239 is on microarray TOM1: SGN-S1-1-4.1.16.2
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C184239 [TUS-44-E5] Trace: SGN-T191876 EST: SGN-E390550 Direction: 5' Facility: INRA
Clone: SGN-C184239 [TUS-44-E5] Trace: SGN-T192111 EST: SGN-E390785 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E231944Length: 552 bp (798 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E231944 [] (trimmed) GCTATTTGCACTCAAAAAAAGATTGTACATCGTGATGTGAAAGCTGAAAATATGTTGATAGATACTAGTAGAAATTTAAAAATTGCTGATTTTGG
AGTTGCTCGTGTTGAAGCACAAAATCCCAAAGACATGACCGGAGAAACCGGAACCCTTGGATACATGGCCCCAGAGGTACTTGATGGCAAGCCTT
ACAACAGAAAATGTGATGTATATAGCTTCGGTATTTGCTTATGGGAAATTTATTGCTGTGATCTCCCATATCTAGATCTAAGCTTCGCTGAAGTC
TCTTCTGCCGTTGTTAGACAGAATTTGCGACCAAATCTCCCGAAATGTTGTCCAAGCTCTGTATCAAATATCATGAAGAAATGCTGGGACGCAAA
TCCAGACAAACGACCTGAAATGGATGAGGTAGTGAAAATGTTGGAAGTCATTGTCACAGACAAAGGAGGATGAATGATACCCTCAGATCAAGTTG
TACAAGGCTGTCTCTGCATTGTTCGTACGAAACTCCGATGTTTCTAATCCACTGGCCCGACTAACCTTGATTGTGCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E231944] SGN-U575750 Tomato 200607 Build 2 26 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T50453 [Download] [View] Facility Assigned ID: TOVBB82TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.956 Expected Error Rate: 0.0077 Quality Trim Threshold: 14.5