EST details — SGN-T52170

Search information 
Request: TOVCE01THBMatch: SGN-T52170
Request From: web userMatch Type: Chromatogram internal Identifier
Clone information 
SGN ID: SGN-C16028Clone name: cLED-15-A1
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E235597Length: 522 bp (672 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E235597 [] (trimmed) CGCTGACAAGGAAAAAGAAGGTAGGAAACCGACATCTGAGGTAGATCTTCCTGAGGCAGAAGTTGGAAAAGTGCGGTTGAGGTTTGCACCAGAAC
CCAGTGGTTATCTCCATATTGGTCACTCAAAAGCAGCATTACTGAACCAGTATTTTGCTGAAAGATATCAAGGGGAAGTTATTATTCGATTTGAT
GATACAAATCCTGATAAGGAAAGCAATGAATTTGTGGATAATCTACTGAAAGATATTGAAACTCTTGGAATTAAGTATAGGACTGTGACATATAC
ATCTGATTACTTTCCACAATTAATGGAGATGGCAGAGAAATTGATTCGTGAGGGTAAAGCCTATGTGGATGATACCCCAAGGGAGCAAATGCAAA
AAGAAAGAATGGATGGAATAGAATCAAGGTGTAGGAACAATAGTGTTGAGGAGAATTTGAAATTATGGAAGGAGATGATTGCTGGTTCAGAGAGG
GGAACAATGTGTTGTGTTAGAGGGAAATTGGATATGCAGGATCCTAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E235597] SGN-U563705 Tomato 200607 Build 2 45 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T52170 [Download] [View] Facility Assigned ID: TOVCE01THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.946 Expected Error Rate: 0.0016 Quality Trim Threshold: 14.5