Notice: Please give us important feedback on the future of SGN using this survey: https://www.surveymonkey.com/r/VJTRHVC

EST details — SGN-T52794

Search information 
Request: TOVCN46THMatch: SGN-T52794
Request From: web userMatch Type: Chromatogram internal Identifier
Clone information 
SGN ID: SGN-C16726Clone name: cLED-17-G20
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C175759 is on microarray TOM1: SGN-S1-1-4.3.11.12
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E238352Length: 616 bp (893 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E238352 [] (trimmed) GTACTTTCTCGCCTAAAACAGTTCTCTGCTATGAACAAGTTAAAAAAGATGGCTTTGCGGGTGATTGCTGAAAGCTTGTCTGAAGAAGAGATTGC
TGGTCTGAGAGAGATGTTTAAGGCCATGGATACTGACAATAGTGGTGCAATTACATTTGATGAACTAAAAGCAGGGTTGAGAAAATATGGCTCTA
CCTTAAAGGATACGGAGATACGGGAACTTATGGATGCGGCTGATGTGGACAATAGTGGAACTATTGACTATGGAGAATTCATTGCGGCAACTGTT
CATCTTAATAAATTGGAGCGCGAGGAACATCTCATGGCAGCATTTCAATATTTTGACAAGGATGGAAGTGGTTACATAACAGTTGATGAGGTCCA
GCAAGCTTGTATAGAGCATAACATGACAGATGTTTACTTTGAGGATATTATAAGAGAAGTCGATCAGGATAATGATGGACGAATTGATTATGGAG
AATTTGTTGCTATGATGCAAAAAGGAAATCCGTGTATAGGGAGACGAACAATGCGAAATAGTCTGAATTTGAGCATGAGAGATGCATCAGGAGCT
CAGTAGTAGCTTCTCAGACAGACATCTCTACTAGGTTGTACAGAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E238352] SGN-U580025 Tomato 200607 Build 2 18 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T52794 [Download] [View] Facility Assigned ID: TOVCN46TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.947 Expected Error Rate: 0.0011 Quality Trim Threshold: 14.5