EST details — SGN-T54851

Search information 
Request: TOVDP80THMatch: SGN-T54851
Request From: web userMatch Type: Chromatogram internal Identifier
Clone information 
SGN ID: SGN-C18851Clone name: cLED-24-M16
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C176080 is on microarray TOM1: SGN-S1-1-3.1.11.16
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C176080 [TUS-23-A6] Trace: SGN-T181183 EST: SGN-E369145 Direction: 3' Facility: INRA
Clone: SGN-C176080 [TUS-23-A6] Trace: SGN-T181184 EST: SGN-E369146 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E240954Length: 448 bp (812 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E240954 [] (trimmed) ATGATTTGCAGTGGTAGGGACAAGATTGAGACTCCAGAGCAGTTTAAGCAAGCTGAAGAGACAGCAAAGAAGCTCGATCTAGATGGTCTTGTCGT
AATTGGTGGAGATGACTCCAATACAAATGCTTGTCTTCTTGCTGAGAACTTCAGAAGTAAAAATTTGAAAACTCGGGTTATTGGATGCCCGAAAA
CCATAGATGGTGACTTAAAATCGAAAGAGGTTCCCACAAGTTTTGGCTTTGATACGGCATGCAAGATATATGCAGAAATGATTGGGAATGTGATG
GTAGATGCTCGATCAACAGGAAAATACTATCATTTTGTGCGGCTCATGGGGCGTGCTGCTTCACACATTACTCTAGAGTGTGCTCTGCAAACTCA
TCCAAACGTTACTTTGATTGGAGAAGAGGTATTTGCAAAGAAACTGACTCTTAAGAATGTTACGGATT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E240954] SGN-U583285 Tomato 200607 Build 2 52 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T54851 [Download] [View] Facility Assigned ID: TOVDP80TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.961 Expected Error Rate: 0.0094 Quality Trim Threshold: 14.5