EST details — SGN-T91822

Search information 
Request: TPRAA15TVMatch: SGN-T91822
Request From: web userMatch Type: Chromatogram internal Identifier
Clone information 
SGN ID: SGN-C72103Clone name: cLER-1-C5
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C184995 is on microarray TOM1: SGN-S1-1-8.4.12.21
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C72103 [cLER-1-C5] Trace: SGN-T91821 EST: SGN-E280267 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E280268Length: 557 bp (827 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E280268 [] (trimmed) CGTCAAAATAATGCAATTGTCAGAAAGCCAAATTACCATTGTACATCATATAGGTAAAACTTATAATGAATCTAGTCTAATAAGACTTTTATGAA
AAACATAAAAGAGAAGAAAATTTTCTGAACAAACAAACAACAGTCATAATTAACTGATAGTATTACAAAGTTTAGAAAGATCTTGGTTTCATCAC
AATGGTGGAATGCTTCAAAATGTGGAGACTGAACTGTCCACCTTTCTCCGAGGTGTCGAGCTTCGACTGCCCTGGAGGAGGCAACATCTCAAAGT
TCTGCACCAAACGTCCAATGGTGATGCCAAGAATTGGCAATGCAAGGATAATTCCGGGGCAACTCCTCCTGCCAACACCGAAAGGAAGAAATCTG
AAGTCGTTGCCATTGGCTTCAACGTGTTTCTCCTCTTCCAAGAACCTCTCAGGTCTGAACTCTTCAGGTTTCTTCCAGTGGGCGGGGTTGTTAGC
TAGCCACCAAGCGTTAACTAAGATTTTGCTCTCAGCTGGAATATCGTATGCAGCAAGCTTTGCATCATGAAGGTTCATGTGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E280268] SGN-U581122 Tomato 200607 Build 2 114 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T91822 [Download] [View] Facility Assigned ID: TPRAA15TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.977 Expected Error Rate: 0.0131 Quality Trim Threshold: 14.5