Notice: The SGN server upgrade is complete. Please let us know if you find any issues. :-)

EST details — SGN-T97378

Search information 
Request: TPSAA16THMatch: SGN-T97378
Request From: web userMatch Type: Chromatogram internal Identifier
Clone information 
SGN ID: SGN-C76958Clone name: cLES-1-C7
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C76958 [cLES-1-C7] Trace: SGN-T97379 EST: SGN-E283703 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E283702Length: 414 bp (849 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E283702 [] (trimmed) GCAGTTTCAACTCCAAAGAGGCCATTTGCTGCTATTGTGGGTGGTTCAAAGGTTTCATCCAAGATTGGAGTGATTGAATCACTTCTGGAGAAATG
TGATATATTGCTTTTGGGTGGAGGAATGATCTTTACCTTCTACAAGGCTCAGGGTCTTTCAGTTGGTTCCTCCTTGGTTGAGGAAGACAAACTAG
AGCTTGCAACATCACTCCTGGAAAAGGCCAAGGCAAAAGGAGTCAGTCTCTTGTTACCATCTGATGTTGTGATTGCAGATAAATTTGCTCCTGAT
GCAAACAGCAAGATTGTGCCGGCATCTGCTATCCCAGATGGTTGGATGGGGTTAGACATTGGACCAGACTCTATCAAGACTTTCAACGATGCTTT
GGATACCACAAAAACAGTGATCTGGAATGGACCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E283702] SGN-U580583 Tomato 200607 Build 2 149 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T97378 [Download] [View] Facility Assigned ID: TPSAA16TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.964 Expected Error Rate: 0.0064 Quality Trim Threshold: 14.5