EST details — SGN-T97689

Search information 
Request: TPSAJ05THBMatch: SGN-T97689
Request From: web userMatch Type: Chromatogram internal Identifier
Clone information 
SGN ID: SGN-C77703Clone name: cLES-3-A10
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C190152 [TUS-59-K14] Trace: SGN-T340616 EST: SGN-E539741 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E284668Length: 294 bp (734 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E284668 [] (trimmed) GAAGATCCAGAGATTGCTGAGGCAGCTGGGATTATGGGTACTCCATGTGTACAGTTTTTCAAGAACAAGGAGATGCTCAGGACGGTATCAGGTGT
TAAAATGAAGAGAGAGTATAGAGAGTTTATTGAAGCAAATAAGTGAAGGCTTGCTTCTTTGTTAATTATTTGTACAACTTCCTTTTTTTTTTACC
CTTCACGAAGTTTTACTTATTTTTTTTAATGCATGGTACCCAAATCAATTTTGTTCAGAATGGTTGATTGAGTAACAGCCCAATACCTTGTATTA
GCTTTATTN
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E284668] SGN-U572332 Tomato 200607 Build 2 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T97689 [Download] [View] Facility Assigned ID: TPSAJ05THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.929 Expected Error Rate: 0.0060 Quality Trim Threshold: 12.5