EST details — SGN-T97580

Search information 
Request: TPSAL05THMatch: SGN-T97580
Request From: web userMatch Type: Chromatogram internal Identifier
Clone information 
SGN ID: SGN-C77720Clone name: cLES-3-B10
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E284559Length: 367 bp (750 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E284559 [] (trimmed) ATAGGCACTGAACATGAAAAGTTTGGTTTCGAGTTTGGAACCCTGCGACCCATGAAGTATGATCAAATAGCTGACTTGCTAAATGGTATTGCTGA
GCGGTTTGATTGGGAAAAAGTAATGGAGGGTGACAAGATTATTGGCCTGAAACAGGGAAAGCAAAGCATATCATTAGAACCTGGTGGTCAGTTTG
AGCTTAGTGGTGCACCACTTGAAACACTGCATCAAACTTGTGCAGAGGTTAATTCACATCTTTACCAGGTTAAAGCTGTTGCAGAAGAGATGGGA
ATTGGATTCTTAGGAACTGGATTCCAGCCAAAGTGGGGGCTGAAAGATATACCAATAATGCCGAAGGGGAGATATGAGATTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E284559] SGN-U563104 Tomato 200607 Build 2 39 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T97580 [Download] [View] Facility Assigned ID: TPSAL05TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.949 Expected Error Rate: 0.0055 Quality Trim Threshold: 14.5