EST details — SGN-T177802

Search information 
Request: TPTAA76TVMatch: SGN-T177802
Request From: web userMatch Type: Chromatogram internal Identifier
Clone information 
SGN ID: SGN-C109970Clone name: cLPT-1-M7
cartOrder Clone
Library Name: cLPTOrganism: Solanum pennellii (formerly Lycopersicon pennellii)

Tissue: leaf trichomes
Development Stage: 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C109970 [cLPT-1-M7] Trace: SGN-T177801 EST: SGN-E366376 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E366377Length: 618 bp (922 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E366377 [] (trimmed) CCCTTTTTTCCGAACAGGGAATCAGGAAACTGGAAATTGGTAATAAAATAAGGAAAAAGTTACAAAACAAAATTATGGAAATCTTCCACGAGTAA
AAGATTGACTCAAAACTGCCATCAGTAACAGATATCAAGTAACTGTTTGTCGAAAGCGCATCCCTTGTTTTCCACATTGAGAGAACAAATCTAAA
GGAACATTTCTATTTCCTCACATAAATATGGCTACTCAAGATTATCACTTAAGGAAATAGATAAATTTACCTCTCCAGAAGCATCACCAGTTCAC
AATGAGGAGAATGTGGAAAAAGATCAACAGCCATGGCTTTGACAGGTTTAAAAGGCTCTGAATTGGGCATAGATTTGGTCCTATGTCGTGCAAGA
GTAGCGCTGCTCATCTTCCTCCATAATCTGTTGTTCCTATTATCCCCCTTTTCCGATTCGTCTGGAGAAGGTGTGCAGAGCTCAATAGCGTTTGC
AACCAAGCTTTCAGGATTACAGGAAATGTAAACAAGCCTCCTTAGACGTGAGTTAGTCCTTAAAAGTTTGATAACAGTGGGATGAAGTCCAGCAC
GTGGAGGATCTACAATTGCAACAACATTCTTGAAATGTTGCACTGGAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E366377] SGN-U576735 Tomato 200607 Build 2 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T177802 [Download] [View] Facility Assigned ID: TPTAA76TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.972 Expected Error Rate: 0.0033 Quality Trim Threshold: 20.5