Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

EST details — SGN-T177927

Search information 
Request: TPTAF91THMatch: SGN-T177927
Request From: web userMatch Type: Chromatogram internal Identifier
Clone information 
SGN ID: SGN-C110214Clone name: cLPT-2-O14
cartOrder Clone
Library Name: cLPTOrganism: Solanum pennellii (formerly Lycopersicon pennellii)

Tissue: leaf trichomes
Development Stage: 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E365321Length: 517 bp (961 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E365321 [] (trimmed) TTGCAGGAAGAGCTTAAAGAGAAGCTTGATTTGATACAAGTTCTTGAAGAAAAGATTACTTTGCTTACTACAGAGATCAAAGATAAAGAGGTGAG
TCTTCGGAGTAGCACCTCTAAACTAGCTGAAAAAGAATCGGAGGTAAATAGTTTGAGCTCTATGTATCAACAATCCCAGGATCAGCTGATGAATT
TGACTTCAGAGATCAAAGAACTTAAAGATGAAATCCAGAAAAGAGAGAGAGAACTGGAGTTGAAATGTGTATCAGAAGACAACCTGAATGTGCAA
TTAAATTCTTTGCTCCTCGAGAGAGATGAATCTAAAAAAGAGCTTCATGTTATTCAAAAGGAATACAGTGAGTTCAAGTCCAATTCTGATGAGAA
GGTGGCTTCAGATGCGAAGCTGTTGGGGGAACAAGAGAAGAGACTACACCAGCTTGAGGAACAACTTGGCACTGCCTTAAGTGAAGCAAGTAAAA
ATGAAGTGCTAATTGCTGATCTGACTCGAGAAAAAGAAAACC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E365321] SGN-U581652 Tomato 200607 Build 2 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T177927 [Download] [View] Facility Assigned ID: TPTAF91TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.931 Expected Error Rate: 0.0080 Quality Trim Threshold: 14.5