EST details — SGN-T178209

Search information 
Request: TPTAN12THMatch: SGN-T178209
Request From: web userMatch Type: Chromatogram internal Identifier
Clone information 
SGN ID: SGN-C110247Clone name: cLPT-4-A24
cartOrder Clone
Library Name: cLPTOrganism: Solanum pennellii (formerly Lycopersicon pennellii)

Tissue: leaf trichomes
Development Stage: 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E364808Length: 518 bp (942 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E364808 [] (trimmed) TTATTTGTTCTATTCTCTTCCTGATTTATTCGCCCAATCTTTACTTCATCCCTTGCGTATTTACCTTAGAACTCAATCGATTACTCTGCCTCTGA
CTTGTTGTGCGATTTTCGCCATTCTCCTGCATATACCCATAAATTTTCTTCTTGTTATCAAGCTTAATTTGGGGGTTAGAGGAGTTGCTATGAGT
GGGGTTTTGACTAATTTTAATCTAGTAGGTTCGTGGATTGTATATATTCTTGTTTCTGGGGTTTACAAAAAGACATGGGAGAAATTGCCAATGGA
GTGTGTTAAAGGATGGAAATCCCTTTTGAATGTAGCCATCCCAAGCTGCATTGCAGTATGTCTTGAATGGTGGTGGTATGAGATCATGATTATGC
TCTGTGGGTTGTTGATTAACCCGAAAGCAACGGTTGCTTCAATGGGCATTTTGATTCAGACGACTTCGGTAATTTACATTTTCCCATCCTCTCTT
AGTTTCAGTGTATCAACAAGAGTTGGGAATGAGGTTGGAGCCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E364808] SGN-U585525 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T178209 [Download] [View] Facility Assigned ID: TPTAN12TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.959 Expected Error Rate: 0.0253 Quality Trim Threshold: 14.5