EST details — SGN-T178519

Search information 
Request: TPTAR66THMatch: SGN-T178519
Request From: web userMatch Type: Chromatogram internal Identifier
Clone information 
SGN ID: SGN-C110614Clone name: cLPT-5-K12
cartOrder Clone
Library Name: cLPTOrganism: Solanum pennellii (formerly Lycopersicon pennellii)

Tissue: leaf trichomes
Development Stage: 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E367250Length: 488 bp (981 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E367250 [] (trimmed) CCCCGGGCTGCAGGTCAGTATACACTTTCTTCTGATAATGGCTTCTGCAAATGGGATTCCCACTGCCTCTATCCTTTCTTCTTCCTCTAAACAGG
TGGGGTTGAAAGGAAGAAGGGTGAACCAATTGCAGGGACAGAAATTCAACAATAAGGCTTCAAAGAGCCGATTAGTAGTAAGGGCGAATGCTAAA
GATATTGCATTTGACCAGAAATCAAGAGCTGCCCTTCAAGCAGGAATTGATAAGCTCGTTAATGTTGTCGGTGTCACTCTTGGTCCTAGGGGGAG
GAATGTGGTTTTAGACGAATATGATACCCCAAAAGTAGTGAACGATGGAGTCACGATTGCTCGAGCCATAGAGCTAGCTGATGCCATGGAAAATG
CAGGCGCAACCCTTATCAGAGAGGTTGCAAGCCTAACCAATGATGCTGCTGGTGACGGGACAACAACTGCATCTGTTCTTGCCAGGGAAATCATT
AAGCATGGTCTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E367250] SGN-U578751 Tomato 200607 Build 2 33 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T178519 [Download] [View] Facility Assigned ID: TPTAR66TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.976 Expected Error Rate: 0.0051 Quality Trim Threshold: 20.5