EST details — SGN-T178520

Search information 
Request: TPTAR67THMatch: SGN-T178520
Request From: web userMatch Type: Chromatogram internal Identifier
Clone information 
SGN ID: SGN-C110616Clone name: cLPT-5-K14
cartOrder Clone
Library Name: cLPTOrganism: Solanum pennellii (formerly Lycopersicon pennellii)

Tissue: leaf trichomes
Development Stage: 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E367251Length: 491 bp (973 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E367251 [] (trimmed) TCTTTAGGGTTTTTCATCTCGATTCATCACACATGGCCGGGATGAGACTGTTACCGGAGGACCCCGACGTCGCGCAGGTCCGACCAACGGCATCA
GCCGATCTGATTTCCGACGACGACCGCTCTGTGGCGGCCGATTCGTGGTCCATAAAGAGCGAATACGGAAGTACTCTCGATGATGAGCAGCGCCA
CGCTGATGCTACTGAAGCTCTTAACTACCGAGCCGATTACAGTTCTGACAAGGATGAGCAGGAAGGTGAAGGAGTTTCTTCAATGCTTGGTTTCC
AAAGCTATTGGGATGCTGCTTACGCCGATGAATTGACAAACTTTCGTGAGCATGGTCACACTGGTGAAGTTTGGTTTGGTGGTGACGTCATGGAA
AATGTTGTCTCATGGACCAAAGGTTTGTGCATGGACATTTGCAAGAGTAATTTGCCAAATCACGTAGCTGATGCCGATTCTGAGCCTGTTGGGCA
GCGTGAGATTGACATT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E367251] SGN-U569447 Tomato 200607 Build 2 43 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T178520 [Download] [View] Facility Assigned ID: TPTAR67TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.980 Expected Error Rate: 0.0029 Quality Trim Threshold: 14.5