EST details — SGN-T178617

Search information 
Request: TPTAU26THMatch: SGN-T178617
Request From: web userMatch Type: Chromatogram internal Identifier
Clone information 
SGN ID: SGN-C110803Clone name: cLPT-6-E3
cartOrder Clone
Library Name: cLPTOrganism: Solanum pennellii (formerly Lycopersicon pennellii)

Tissue: leaf trichomes
Development Stage: 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C110803 [cLPT-6-E3] Trace: SGN-T178618 EST: SGN-E366763 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E366762Length: 547 bp (900 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E366762 [] (trimmed) TTTTTTTTTGTCTATACAGAATTGAGCTTCTGCCATTGATTTGAGCTCAACAAAATTAAAAAAAAAAACATGGAGCCGATAACTCAAAGAAGAAA
GAGTGGAATTAACCTTCCATCTACAATGTCGGAAACCTCTCTTCGTCTTGATGCTTTTTCTTCTCCTCCCAGATCAAAGCGAACAACCAATTTGG
CTTCATCGCCAATGTCAAACAGGTCACCTCGGACAATATCGAATCTGTCATCATCTCCGTCTTCTAAATCTGCAAGTTGCAGTGATAGATTCATT
CCTTGTAGATCTTCTTCAAGGCTGCATACTTTTGGTCTGGTGGAGAAGGCGTCTCCGGTGAAAGAAGGAGGAGGAGGAAACAATGATGCATATTC
CAGGTTGTTGAAATCTGAGCTTTTTGGAGCTGATTTTAGTTGTTTCTCTTCTCCTGCAGGTTCTAAGGGATGTGCTAATTCACCCATGAGTCCCA
GTAAGAATATGCTCAGATTTAAAACTGAAAATTCTGGCCCTAATTCCCCTTCCGTTTTGGGGCATACAGATA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E366762] SGN-U570172 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T178617 [Download] [View] Facility Assigned ID: TPTAU26TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.965 Expected Error Rate: 0.0090 Quality Trim Threshold: 14.5