EST details — SGN-T178725

Search information 
Request: TPTAW90THMatch: SGN-T178725
Request From: web userMatch Type: Chromatogram internal Identifier
Clone information 
SGN ID: SGN-C110962Clone name: cLPT-6-P11
cartOrder Clone
Library Name: cLPTOrganism: Solanum pennellii (formerly Lycopersicon pennellii)

Tissue: leaf trichomes
Development Stage: 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E366870Length: 506 bp (926 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E366870 [] (trimmed) GCCAAAGATGTGTTCGTCCAATTTTTGACAATCCTTTTCTTAAGATTCAAGAATTACCAGGTAACACAGTTAAACGTAACTCTGAATCCCTCAAA
CAAGCCAATTGTGATCCAAAAGGCACATCATTAGTCGTAACAAGGGATGTTGATCTTGACACAGCAGAAAACACTTGGCTGCGACTATACGTCCC
AAGACGTTTGACAAAAAATCCAAATCCTAAGAAATTGCCACTGATTATGTACTATCACGGGGGAGGCTTTGTTTATTTCCATGCCAATACTTTTA
TATTCGATGTGTTTTGCCAGGCACTTGCTGAAAGAGTTGGTGCTATGGTGATTTCACTTGAATATCGTCTAGCCCCTGAACATCGCCTTCCTGCT
GCTTATGATGATGCTATGGATGGGTTAGAATGGCTTAAGAATACCAAGGATGAATGGGTTTGTAATTATGCTGATTTGAGTAAAGTTTTTCTTGG
TGGAACTAGTTCTGGAGGAAATTTAGCTTAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E366870] SGN-U600754 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T178725 [Download] [View] Facility Assigned ID: TPTAW90TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.968 Expected Error Rate: 0.0116 Quality Trim Threshold: 14.5