EST details — SGN-T179124

Search information 
Request: TPTBA93THMatch: SGN-T179124
Request From: web userMatch Type: Chromatogram internal Identifier
Clone information 
SGN ID: SGN-C111229Clone name: cLPT-7-P17
cartOrder Clone
Library Name: cLPTOrganism: Solanum pennellii (formerly Lycopersicon pennellii)

Tissue: leaf trichomes
Development Stage: 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E367562Length: 477 bp (1071 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E367562 [] (trimmed) AAAAAACTATAGATTATTTTATCACTTTCAAATATCAAAATTCTTAGTTCTCAACTATGGGTGGTGACAATACTGAGAAGATTACCATAATGATG
CTAAAGGTTGATCTTCAATGTTCAAGCTGCTACAAACAAGTCAAAAAAATTCTCTGCAAATTCCCTCAAATTCGAGACCAAGTGTATGATGAAAA
GGCCAATATATACAATTACTGTATTGTGTTGCAATCCTGAAAAAATTCGTACAAATTGTGTTGCAAAGGAGGGGGAGTAATCAAGAGCATTGAGA
TCAAAGAGTCTCAAAAGCCTAAAGAACCGAAAAGCCCAAAAAGCCTGAAAAGCCCGAAAATCAAAGTGGTGGTGGTGGAGAAGCCTAAAGAGCCC
GAAAAACCTAAAGTAGTGGTCGTGGAGAAGCCTAAAGAACCGGAGAAACCCAAAGTGGTGGTTGCAGAGAAGCCTAAAGAATCAGAAAAACCTAA
AG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E367562] SGN-U578859 Tomato 200607 Build 2 25 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T179124 [Download] [View] Facility Assigned ID: TPTBA93TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.927 Expected Error Rate: 0.0174 Quality Trim Threshold: 14.5