EST details — SGN-T179282

Search information 
Request: TPTBC34THMatch: SGN-T179282
Request From: web userMatch Type: Chromatogram internal Identifier
Clone information 
SGN ID: SGN-C111297Clone name: cLPT-8-E19
cartOrder Clone
Library Name: cLPTOrganism: Solanum pennellii (formerly Lycopersicon pennellii)

Tissue: leaf trichomes
Development Stage: 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E365783Length: 480 bp (843 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E365783 [] (trimmed) GGAATTCGGCACGAGGGCCGCTTCTACGACAGCAAACCCACCCGAATCCAAAAGTTGGGCAGACCAAGCCGACGAGATCGATCAAGCTGAGCAGT
CTTCCGCTTCTAATGAGGACGCTGCTGCCGAGATAAATATCGGATCTCTACAAGTCGATGAGTCCAAAAGAGACAACTCCACTCTCTCTGATCCG
GAAGATTCCAGCATAGAAGCGGTTACGTCTGGCGATACTATGTACAAATCAGCGAAGAGATTTGAGGATTTGAACTTATCTCCTGAGCTATTGAA
GGGATTATATGTACAAATGCAGTTTGAGCGTCCTAGCAAGATTCAGGAAATTAGTTTGCCTATGATTCTTACGCCTCCGTACAAGAATCTTATTG
CTCAGGCTCATAACGGTTCTGGTAAAACTACTTGCTTTGTGCTTGGGATGTTGAGTCGAATTGATCCAAAGCTTGCTGCCCCTCAAGCTCTCTGT
ATCTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E365783] SGN-U586037 Tomato 200607 Build 2 67 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T179282 [Download] [View] Facility Assigned ID: TPTBC34TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.985 Expected Error Rate: 0.0039 Quality Trim Threshold: 20.5