EST details — SGN-T179342

Search information 
Request: TPTBD96THMatch: SGN-T179342
Request From: web userMatch Type: Chromatogram internal Identifier
Clone information 
SGN ID: SGN-C111438Clone name: cLPT-8-O24
cartOrder Clone
Library Name: cLPTOrganism: Solanum pennellii (formerly Lycopersicon pennellii)

Tissue: leaf trichomes
Development Stage: 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E365843Length: 831 bp (untrimmed)
Status: Contaminants not assessed Chimera not assessed Direction: 5'
>SGN-E365843 [] (untrimmed)
AGCTCCACCGAGTTGGCGGCCGTTCTAGAACTAGTGGATCCCCCGGGCTGCAGGAATTCGGCACGAGGGAGAGAACTAGTCTCGAGTTTTTTTTT
TTTTTTTTTTAGATTAAACAAAGATGGTTCTTGAAGCCATCACAAAGAAGTGGGAACTACAAATATCATGGAAGTCAAATCATCTGGTATAAAAA
GAGGCAAGACATGGAACAGTAATACAAAAGAAAAATCTGAGTATTGCTTCCTTTAGTGAGAAACATAAACCTTCAAAAGTTTGCAGGTTCACAGA
AAATGATCAACTAAATAAATAAGTCTTGGGCTTTTTCTCACATCGTCGAGGAAATGGTCTACAGGAAAGGAGGCAATATCACCCATCGTCGAGGA
TATTTTGGTCTTCCTTCCTTTCCATCAAAGAGCTTCTTCAGACGACGATGCTTTCCAAGAGCCCAGTTAGTCATAATGCTAGCAGCAACAATCAT
GAAGATATAGCCTGCAACAGTCTGAGTAGCAATGTTGAAGCCCAACCACTGGTAGATCTCTGTTGTGTAATTTGCACAGGTGACAATATTGAACA
AGAAGCCACGGGGTATTTGGTAACCTNCATTACCACTGGGACTTCGAAGATTCTCAACAATAAATGACAATACAAGTTTGCCACTTGACAACTAT
CCCAAACCAAATCCAATCTTCATCTTGAGATCACTACAGAGTTTAAAGAGATGATTCCGAAGTAAGCATTGAAGCTCCAAAGACCAATATTGGCA
CAGTTCGGAAACATTGAAATTGGAAATTGCGTTGTTGAACGTGCCCAAGAAGTTCCTTATCCCTTGAATAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T179342 [Download] [View] Facility Assigned ID: TPTBD96TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: Multiple cloning site sequence detected -- chimeric clone suspected.
Problems: Possibly chimeric (anomalous insert into vector)
Too short after trimming low-quality bases
Low complexity
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: 0