EST details — SGN-T179345

Search information 
Request: TPTBF09THMatch: SGN-T179345
Request From: web userMatch Type: Chromatogram internal Identifier
Clone information 
SGN ID: SGN-C111261Clone name: cLPT-8-B18
cartOrder Clone
Library Name: cLPTOrganism: Solanum pennellii (formerly Lycopersicon pennellii)

Tissue: leaf trichomes
Development Stage: 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E365846Length: 435 bp (894 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E365846 [] (trimmed) TCACTTCAAGAAATGGCAGCATCTGCAGCTTCAAGCTTTCAAATAACAATAGCTAGGCCATCCATACTCTCTACTAAAAGAATTTCCAGTTTCTG
CTCGACAAAGTTTGGCGGTGAAACTCAAAAACTGTCCTGTAACAGACTTGCCAGTAGTTGTCATGTTTCATCCATCCAACATTTTTGGCGCAGTT
TCACATCTACGACTCAAAAGTTTCAGAAAGTTGTTACCAAGGCAAAATCAGAAGCTGATGATAGCAAGCCCGCCTCTGTTTTGCCGATTGATTTG
AGAGGTAAAAGGGCTTTTATAGCTGGTATAGCTGATGATAATGGATATGGGTGGGCTATTGCTAAGTCCCTGGCTGCTGCAGGTGCCGAAATTCT
AGTTGGAACCTGGGTGCCAGCCTTAAACATTTTTGAAACAAGTCTTCGACGTGGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E365846] SGN-U568214 Tomato 200607 Build 2 10 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T179345 [Download] [View] Facility Assigned ID: TPTBF09TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.973 Expected Error Rate: 0.0046 Quality Trim Threshold: 14.5