EST details — SGN-T115454

Search information 
Request: TRXAG03THMatch: SGN-T115454
Request From: web userMatch Type: Chromatogram internal Identifier
Clone information 
SGN ID: SGN-C94009Clone name: cLEX-2-B5
cartOrder Clone
Library Name: cLEXOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: fruit-set stage/post-fruit loading

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E303366Length: 577 bp (874 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E303366 [] (trimmed) GCTTCGACTGTGATAAAAATGGAAATATTGTTACTAATTATCATGTGATTCGAGGTGCTTCTGATCTCAAAGTGACTCTTGCTGATCAAACTACT
TATGATGCAAACGTTGTTGGATTTGACCAAGATCAAGATGTTGCTGTGTTGCATATTGATGCACCAAAAGACAAGTTGCGACCTATACCAATTGG
CGTCTCGGCAGACTTGCTCGTTGGTCAAAAAGTATTTGCTATTGGAAATCCATTTGGACTTGATCATACACTCACCACTGGTGTAATCAGTGGGC
TTAGGAGAGAAATCAATTCTGCGGCTACTGGCCGACCAATCCAAGATGTTATTCAGACAGATGCAGCAATCAATCCTGGTAACAGTGGAGGGCCA
CTTATAGATAGTTCTGGAAATCTTATTGGAATAAATACTGCTATATATTCTCCTTCCGGAGCATCATCAGGTGTTGGATTTTCAATTCCAGTTGA
TACTGACAGTGGCATTGATGATCAGTTAGTGCAGTTTGGGAAAGTCACAATGCCAATTCTGGGCATAAAGATCGCACCTGATCAGTCCGTAGAGC
AACTGGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E303366] SGN-U563106 Tomato 200607 Build 2 14 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T115454 [Download] [View] Facility Assigned ID: TRXAG03TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.976 Expected Error Rate: 0.0194 Quality Trim Threshold: 14.5