EST details — SGN-T118037

Search information 
Request: TRXCA53THMatch: SGN-T118037
Request From: web userMatch Type: Chromatogram internal Identifier
Clone information 
SGN ID: SGN-C93388Clone name: cLEX-14-I9
cartOrder Clone
Library Name: cLEXOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: fruit-set stage/post-fruit loading

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C180115 [TUS-33-I9] Trace: SGN-T186493 EST: SGN-E374041 Direction: 3' Facility: INRA
Clone: SGN-C180115 [TUS-33-I9] Trace: SGN-T186494 EST: SGN-E374042 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E305551Length: 655 bp (884 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E305551 [] (trimmed) GAGTCCAAGATGATTTGAAGCGTGCAACTGGAGAATTTGTCAAAGATGAGACAGATGCTAATAAACTTAACCGGGTTCTGCAACTAACAGGATTT
AGCGACCCTGTTTATGCGGAAGCATATGTAACAGTTCATCATTATGATATTGTCCTGGATGTGACAGTTATTAATAGAACTAAAGAGACCCTCCA
GAATTTATGTTTGGAATTGGCAACTATGGGTGATCTTAAACTTGTTGAGCGTCCACAGAATTATACTCTAGCTCCTGAGTCGAGCAAACAGATAA
AAGCAAACATCAAGGTGTCCTCAACTGAGACTGGCGTCATTTTTGGGAACATTGTTTATGAGACATCGAATGTGTTTGACCGGATGGTGGTTGTG
CTAAATGACATTCATATTGACATCATGGATTATATATCCCCTGCAGTGTGCAGTGATGCTGCTTTTAGAACCATGTGGGCAGAATTTGAGTGGGA
AAACAAGGTTGCTGTCAACACTGTCATTCAAGATGAAAAAGATTTTCTTGACCATATAATCAAATCAACCAACATGAAGTGCCTTACTGCGCTGT
CTGCTTTGGAAGGGGAATGCGGGTTTCTCGCTGCTAACTTGTATGCAAAGAGCGTGTTTGGCGAGGATGCTTTGGTGAATGTAAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E305551] SGN-U572670 Tomato 200607 Build 2 17 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T118037 [Download] [View] Facility Assigned ID: TRXCA53TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.973 Expected Error Rate: 0.0026 Quality Trim Threshold: 14.5