EST details — SGN-T121716

Search information 
Request: TRZAA16THMatch: SGN-T121716
Request From: web userMatch Type: Chromatogram internal Identifier
Clone information 
SGN ID: SGN-C99917Clone name: cLEZ-1-C7
cartOrder Clone
Library Name: cLEZOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: germinating seedlings

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C99917 [cLEZ-1-C7] Trace: SGN-T121717 EST: SGN-E309027 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E309026Length: 645 bp (877 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E309026 [] (trimmed) GGTGAACTCTACAACAGAGCCAAACCCTTTCTTGCAGTCATTTTTCTCCAATTTGGGCTAGCAGGCATGGATATTCTCACCAAAGTGGCCTTGAA
TGAAGGAATGAGTAACTATGTATTTGTTGTGTACCGCCATGCAGTTGCCACTTTGGTTATTGCTCCTTTTGCAATAATTCTAGACAAGAAAGTAA
GACCAAAGATGACCCCCTCAATATTTGCTAAGTTGGTACTTCTTAGCTTACTGGAGCCTGTCATCGACCAGAATCTCTACTCTATTGGCCTGAAA
TACACAACAGCAACGTTTGCAGCTGCAATGTGCAACATTCTTCCTGCCATTACTTTTATAATGGCCTGGATATTCAGGCTTGAGAAGGTGAAGCT
TACAAGCATCCGCAGCCAAGCCAAAATAGTTGGGACTGTTGCCACAGTGGCAGGAGCCATGATCATGACACTGGTACGAGGTCCAATAGTTGAAC
TATTTTGGACAACAGGAAATGCCGGTCATAACTCTCAAAGTGGTGGGTTAAATCTAAGCCATGCTATCAAAGGTTCCATCATGATAACAATTGGG
TGCTTCAGTTGGGCTGCATTCATGATTTTGCAGGCAATCACACTGCGGACTTATCCCGCTGAGCTCTCGCTCACT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E309026] SGN-U565049 Tomato 200607 Build 2 13 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T121716 [Download] [View] Facility Assigned ID: TRZAA16TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.971 Expected Error Rate: 0.0033 Quality Trim Threshold: 14.5