Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

EST details — SGN-T122140

Search information 
Request: TRZBD55THMatch: SGN-T122140
Request From: web userMatch Type: Chromatogram internal Identifier
Clone information 
SGN ID: SGN-C100489Clone name: cLEZ-8-I14
cartOrder Clone
Library Name: cLEZOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: germinating seedlings

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E310174Length: 631 bp (930 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E310174 [] (trimmed) CGAGGGTTACCCAGAAATCCATGGGGACCTGTTGTCGAGTCTGCTAACCAGGGAGCAGTAAGCCTGCCAACCAACAAGAAGGTCACTGTTATCTT
TGTTCTAGGTGGCCCAGGCAGTGGTAAGGGCACCCAATGTGCTAATATTGTTGAACACTTTGGGTACACCCATCTAAGTGCTGGTGATCTTCTCC
GAGCAGAAATAAAATCTGGTTCCGAGAATGGGACGATGATTTCGAACATGATTAAAGAAGGGAAGATTGTTCCGTCAGAGGTAACAGTTAAGCTT
CTCCAACGAGCAATTCAGGAAAATGGCAATGACAAATTTCTTATTGATGGTTTCCCCCGGAATGAGGAGAATCGTGCTGCTTTTGAGTTGGTCAC
TGGAATTGAGCCTGAGTTTGTGCTCTTCTTTGATTGTCCTGAAGCAGAGATGGAGAAACGCCTTTTAGGTCGGAACCAGGGAAGAGAAGATGATA
ATATTGAAACAATAAAGAAGCGATTCAACGTTTACATGGAATCTAGTCTACCTGTTATTGAACATTACAACTCCAAGGGGAAGGTTCGAAAGATT
GATGCTGTAAAGCCTGTTGGAGAAGTATTTGAAGCCGTTTAAGCTGTTTTTGCCCCATCTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E310174] SGN-U566261 Tomato 200607 Build 2 31 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T122140 [Download] [View] Facility Assigned ID: TRZBD55TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.977 Expected Error Rate: 0.0096 Quality Trim Threshold: 14.5