EST details — SGN-T122175

Search information 
Request: TRZBF48THMatch: SGN-T122175
Request From: web userMatch Type: Chromatogram internal Identifier
Clone information 
SGN ID: SGN-C100482Clone name: cLEZ-8-H24
cartOrder Clone
Library Name: cLEZOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: germinating seedlings

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C193340 [TUS-67-P10] Trace: SGN-T346098 EST: SGN-E545223 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C193340 [TUS-67-P10] Trace: SGN-T346099 EST: SGN-E545224 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E310209Length: 522 bp (827 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E310209 [] (trimmed) GCTTCAACTGGCCGGAGTTGCTTCCAATTTCCGATGACGGAGCAAAACGCTGACGAAGCCAACACTGTTCAAACTTCGAATATTGACAATGTAGA
ACTGGCAATAGTTGATGGCTCTCATTCCGACACCGCCCAGAAATCAGAACCACTAATTGAAGAACTACAAGATGAAGAACTAAGGAAACTTTTGG
TGCCGAAGTTAGAAAACCTCCCAATTTCTCCTCCTTCTGCTGTTGAATCCAATTTCGTCACCTATTTTGCTCCTGATTTTATGAAACCTGGGCAT
GATCAGTATGTTCATCGACATGCCAATGGATTGTGCATAATTGGGTTGGCTCCGACCCACATTGCTTTTAAGGATGAAGGCGGAGTTACTTCGGT
TGATTTCAATGTGGGGAAGTCTGATCGGAGTGGAATCAAGGTCTCTGGAAAGCGAAAAAAGAACGCTCAACATTTTGAGTCTAATACAGCATTAT
GTAAAGCCTGCACAAAGGATGGTTCTTATATTGTGAGGTGTTGTGTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E310209] SGN-U573426 Tomato 200607 Build 2 14 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T122175 [Download] [View] Facility Assigned ID: TRZBF48TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.980 Expected Error Rate: 0.0044 Quality Trim Threshold: 14.5