EST details — SGN-T122219

Search information 
Request: TRZBG63THMatch: SGN-T122219
Request From: web userMatch Type: Chromatogram internal Identifier
Clone information 
SGN ID: SGN-C100758Clone name: cLEZ-9-K5
cartOrder Clone
Library Name: cLEZOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: germinating seedlings

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E311614Length: 576 bp (970 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E311614 [] (trimmed) GAAAAAATGGGACAAGTGAAGTTGATAGGGTCATCAGGGAGCTTATTTTGCACTAGAGTAGAATGGGCTTTGAAGCTCAAGGGAGTTGACTATGA
ATATATACAAGAAGATTTATTGAACAAGAGTGAGTTGCTCATCAAGTCCAACCCTGTTCATAAGAAGATCCCTGTCCTACTACACGACGACAAAC
CCGTCGTTGAATCTCTGCTTATTCTTGAATATATTGATGAAACATGGAAAGGATACCCTCTGTTGCCTCAGGATCCTCATGAACGAGCTACAGCT
CGTTTCTGGGCAAAATTTGTTGATGACAAGTGTGTCATAGGATCATGGGAAGCTATGGCAATGCAAGATGAAGGAGAGGCAAAAACAAAAGCTAT
AGAGTCAATACAAGAATTGTATGCATTTATCGAGAAGCAGATTGAAGGCAAGAAGTTTTTTGGCGGGGAGCAGATAGGCTACCTGGATCTAGTTA
TGGGTTGGAAAACTCTTTGGCTCAGTGCCATGGAGGAAGTAGGAAATGTGAAGCTACTTGATCCAGAGAAGTTCCCTTCACTCCATCAATGGGCT
GAAAAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E311614] SGN-U585986 Tomato 200607 Build 2 10 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T122219 [Download] [View] Facility Assigned ID: TRZBG63TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.970 Expected Error Rate: 0.0116 Quality Trim Threshold: 12.5