EST details — SGN-T122347

Search information 
Request: TRZBG82THMatch: SGN-T122347
Request From: web userMatch Type: Chromatogram internal Identifier
Clone information 
SGN ID: SGN-C100790Clone name: cLEZ-9-M19
cartOrder Clone
Library Name: cLEZOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: germinating seedlings

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C193388 [TUS-68-B10] Trace: SGN-T346181 EST: SGN-E545306 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C193388 [TUS-68-B10] Trace: SGN-T350060 EST: SGN-E549185 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E311742Length: 549 bp (1003 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E311742 [] (trimmed) GGCCAATCATGAACACATCAGATTTACTTTGGACAAGCATGGGGAATTCAACAATGCAAAAAATCATTTTCAACATGTTGGTTCACAACAATAAA
TCTGTGAAATCAGCAGATTGGCTTATTTGCAACTCAACATATGATCTTGAACCAGGAGCCTTCAAACTAGCACCAGAGATAGTGCCTATAGGTCC
ACTTTTTTCAAACAACTCACTCGAATCAAACGCGTTGTCACTTGAAGCAGAAGCCCTTATATCTTCTAGAGAATCTCCTAATTCACTAGCCGGAT
CGTTCTGGCCCGAGGACTCAACTTGTCTAGACTGGCTTGATCAACAACCATTATGCTCAGTTGTGTATGTAGCCTTTGGGAGCTTCACAATATTC
AATGAAACTCAGTTTCAAGAATTGGCATTAGGGCTTGAACTATCAAACAAACCATTCTTATGGGTTGTGAGAACTACTACTCTAGATACTAAAAG
TGACATTTTCTTGAAAAAAATTGAAGAAAAAATAGGGAGGCAAAAGGGGAAAATAGTGAGTTGGGCACCACAAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E311742] SGN-U584993 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T122347 [Download] [View] Facility Assigned ID: TRZBG82TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.962 Expected Error Rate: 0.0069 Quality Trim Threshold: 14.5