EST details — SGN-T122548

Search information 
Request: TRZBK20THMatch: SGN-T122548
Request From: web userMatch Type: Chromatogram internal Identifier
Clone information 
SGN ID: SGN-C98485Clone name: cLEZ-10-C15
cartOrder Clone
Library Name: cLEZOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: germinating seedlings

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C193402 [TUS-68-B24] Trace: SGN-T346205 EST: SGN-E545330 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C193402 [TUS-68-B24] Trace: SGN-T350064 EST: SGN-E549189 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E309878Length: 461 bp (979 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E309878 [] (trimmed) GATTTGTTCGAAGGGGATGCTGAGATTGCCTTTGCTCGTGTTAGAAGCAAGGTGAAAGTTCCACTGTACGGATGTGACTGCTATGCTTATGCCCT
ATTGGCTTCTGGATTTGTGGATCTTGTAGTAGAGTCTGGTCTTAAGCCGTACGACTTCCTCTCACTTGTACCAGTAATAGAAGGTGCTGGAGGAA
CAATAACCGACTGGAAAGGCCAACATTTTAATTGGAAAGCTTCTGCTGGTTCACCAGCCACAAGTTTTAATGTAGTGGCAGCCGGTGATAAAGAA
GTTCACCAAGAAGCTCTGGATGCATTGCAGTGGCGGTAGAGGCTGCTATGTTTCACTGTATTGGCTCACAACTCCCTTTGGCGAATATCATAGTT
ATTGATTACTTTGCCGCTGAGTCTCTACATTAATTTTAACTTTTGAATCAAATTATGGTGGTCCTCTGTTGATAGTTATTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E309878] SGN-U577734 Tomato 200607 Build 2 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T122548 [Download] [View] Facility Assigned ID: TRZBK20TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.979 Expected Error Rate: 0.0131 Quality Trim Threshold: 12.5