EST details — SGN-T122536

Search information 
Request: TRZBM68THMatch: SGN-T122536
Request From: web userMatch Type: Chromatogram internal Identifier
Clone information 
SGN ID: SGN-C98589Clone name: cLEZ-10-L15
cartOrder Clone
Library Name: cLEZOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: germinating seedlings

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C193420 [TUS-68-C18] Trace: SGN-T346236 EST: SGN-E545361 Direction: 5' Facility: INRA (MWG)
Clone: SGN-C193420 [TUS-68-C18] Trace: SGN-T350069 EST: SGN-E549194 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E309866Length: 379 bp (887 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E309866 [] (trimmed) CAATGCAGTATCCTCAAGCAACAGCTGCACCAGAGAGGGCGCGCGCCCGTAGCCTCGCGGTCTTCTCCCCAAAAATAATCACTTGCAAAAATCGG
CAGCAAGCTTCGCATTTCTGTTCCACAAAGTTTGGCTCAGCTCTTCCGTCCGGCACGTCTCTGTCAATTTCGCGTCGGGCGAACTACAATGCCGC
CGTACGGGCAACTTCGTCTTCATTCTCCAGCTCTGCCTCACCGTGGGATGAAAAACCCTACCAAGTTTTACCGAATGGCAAGATAGTGTACTTGG
ACGAACAGGATGTAGTCACCTTCCTTGACCCTCCCATGGAGCTTATTCCTTTGGATCCATCTTCTTATAATCCCGCCCTTTATCTCTGGAAGAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E309866] SGN-U563694 Tomato 200607 Build 2 12 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T122536 [Download] [View] Facility Assigned ID: TRZBM68TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.980 Expected Error Rate: 0.0126 Quality Trim Threshold: 20.5