EST details — SGN-T122688

Search information 
Request: TRZBP68THMatch: SGN-T122688
Request From: web userMatch Type: Chromatogram internal Identifier
Clone information 
SGN ID: SGN-C98686Clone name: cLEZ-11-K16
cartOrder Clone
Library Name: cLEZOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: germinating seedlings

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E308768Length: 536 bp (909 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E308768 [] (trimmed) GATGGAGTGGAGTTCACTGTTCAAGATGGTCATTTTTGTCCTGCTCTTGCTAAAGCTGTGAAAACTATGAAGAAAGGTGAAAAGGTCCAATTGAC
AGTGAAGCCACAATATGGCTTCGGAGAGAAAGGAAAACCAGCCTCGAGTGATGGAGGAGCAGTTCCTCCTAATGCCACATTACAGATCAACTTGG
AGTTGGTCTCCTGGAAAACTGTTTCAAATGTTACTGATGACAAGAAAGTAGTAAAGAAGATCTTGATAGAAGGGGAAGGATATGAGAGACCCAAT
GAAGGAGCTGTTGTTAAATTAAAACTGGTTGGCAAGCTGCTAGATGGCACAGTCTTCACAAAGAAGGGCCATGATGGGGAAAGTGAAGATAATCT
TTTTGAGTTTAAGACAGATGAGGAACAAGTAATTGATGGGCTGGACAGAGCTGTCATGACAATGAAGAAAGGTGAAGCGGCGCTGCTTACAATTG
CACCTGAATATGCCTTTGGTTCATCTGAGTCGAAGCAAGATTCAGCTGTTGTTCCTCCTAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E308768] SGN-U567765 Tomato 200607 Build 2 114 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T122688 [Download] [View] Facility Assigned ID: TRZBP68TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.952 Expected Error Rate: 0.0106 Quality Trim Threshold: 14.5