EST details — SGN-T122657

Search information 
Request: TRZBP76THMatch: SGN-T122657
Request From: web userMatch Type: Chromatogram internal Identifier
Clone information 
SGN ID: SGN-C98703Clone name: cLEZ-11-M8
cartOrder Clone
Library Name: cLEZOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: germinating seedlings

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C193439 [TUS-68-D13] Trace: SGN-T346269 EST: SGN-E545394 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E308737Length: 565 bp (902 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E308737 [] (trimmed) GAGACAACAATGAAACATCAATGGACAATATTACTCCAAATTTATTTGATAATTCATATTATCATGTCTTACTTAAAGGTGAAGGACTCATAAAT
TCAGATCAACAACTTTATTCAAGTTTTCTTGGGATTCAAACTAAAAAAATTGTTGAAAAATATGCAACAAATACAATTGCATTTTTTGAACAATT
TGCTGAATCAATGGTCAAAATGGGAAATATTACAAATCCAGAGACTTATGTGAATGGAGAAGTGAGAAAGAGTTGTAGGTTTGTGAACACATAGA
AGAAGAAAAAAAATATATTGAGTTAATTATGTAATATTATTATACACACAAAAAAAAATTGTTTGGGTTTTGTATTTGATTTTGTTTGTAATTTC
TCAAAAAGAAAAATTATGATGTTATTAATAAGAATTATTGAAGCTTTTGTTATAATGTAATGTGCCACGTGTGAATTTAGATAAGTCTATAGTTG
AATGATGATACAGAATATCGACGAAAATAGTGAAATATTTTAATGTATGAACTTATATTGGTTTGGATTTTATACAAACTCTTTGAAATT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E308737] SGN-U573040 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T122657 [Download] [View] Facility Assigned ID: TRZBP76TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.882 Expected Error Rate: 0.0149 Quality Trim Threshold: 12.5