EST details — SGN-T122698

Search information 
Request: TRZBP93THMatch: SGN-T122698
Request From: web userMatch Type: Chromatogram internal Identifier
Clone information 
SGN ID: SGN-C98707Clone name: cLEZ-11-O18
cartOrder Clone
Library Name: cLEZOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: germinating seedlings

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C193443 [TUS-68-D17] Trace: SGN-T346275 EST: SGN-E545400 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C193443 [TUS-68-D17] Trace: SGN-T346276 EST: SGN-E545401 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E308778Length: 344 bp (905 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E308778 [] (trimmed) GAAAATCTCGGAGAGAGAAAGCACATGGTGTTTGTTTCCTCCGGCGATCATTCGGCAAAATGATCTCTGTCACCTAGTCGGAGCTCAACTACCTC
GTTTTCCGGTACCTTCAGGAATCAGGGTTCACACATTCCGCATTTGCTTTAGGATATGAGGCAGGGATCAATAAGAGCCCAATAGATGGAAATTT
AGTTCCTCCTGGTGGTCTGGTTACCTTTGTACAAAAGGGAATCCAATATCTTGAATTGGAAGCAAATTTGACCAATGATGACACAGATATGGACG
AAGACTTCCAGTTTATACAGCCCATTGATCTTATCACCAAGGATGTCTATGAACTACAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E308778] SGN-U582730 Tomato 200607 Build 2 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T122698 [Download] [View] Facility Assigned ID: TRZBP93TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.972 Expected Error Rate: 0.0107 Quality Trim Threshold: 12.5