EST details — SGN-T22852

Search information 
Request: TSHAK67THMatch: SGN-T22852
Request From: web userMatch Type: Chromatogram internal Identifier
Clone information 
SGN ID: SGN-C499Clone name: cLEB-3-L13
cartOrder Clone
Library Name: cLEBOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: vegetative shoots including meristems and small expanidng leaves
Development Stage: 8 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C499 [cLEB-3-L13] Trace: SGN-T22853 EST: SGN-E203107 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E203106Length: 560 bp (887 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E203106 [] (trimmed) CTCTCATTCCAAAGAATCAGGAAGATGCAGCCATCAGGTGCAGAAGTTCACCAACGAATAGCCAGAATTTCAGCTCATCTTTACCCTTCAAATCC
CCAGATGGGAGATGGGTCTATTTTGGAAAGAACAAATTGCAGAGCAAAAGGTGGAGCAGCTGGATTCAAAGTTGCTATACTGGGTGCTGCTGGAG
GAATTGGGCAGCCACTTGCAATGTTGATGAAGATGAATCCTTTAGTCTCAGTTCTTCATCTCTATGATGTTGTTAATGCTCCTGGTGTTACTGCT
GATATTAGCCACATGGACACTGGTGCTGTTGTGAGGGGTTTTCTAGGGCAAAGTGAGCTTGAAGGTGCACTTACAGGAATGGACCTTGTGATCAT
ACCTGCTGGTATTCCAGAAAAACCTGAAATGACAAGAGATGATCTTTTTAAGATTAATGCTGGAATTGTGAGGACCCTCTGTGAAGGAATTGCAA
AGTGCTGTCCTAATGCTATTGTCAATTTGATTAGTAATCCAGTGAACTCCACAGTTCCTATTGCAGCTGAAGTTTTCAAGATAGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E203106] SGN-U574919 Tomato 200607 Build 2 86 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T22852 [Download] [View] Facility Assigned ID: TSHAK67TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.956 Expected Error Rate: 0.0141 Quality Trim Threshold: 14.5