EST details — SGN-E1239870

Search information 
Request: 1239870Match: SGN-E1239870
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C980869Clone name: LECAD01J23
nocartOrdering Not Available
Library Name: LeCADOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Seedling
Development Stage: Two-week-old seedings

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E1239870Length: 331 bp (331 bp untrimmed)
Status: Current VersionDirection: Unknown
>SGN-E1239870 [] (trimmed) ACAACTTGGAAGCCCAATACTGCTAGAATGCTCTGAGCATGGACAAGGTTTGGGTTGCCCAAATAGTCCAGCCCACCTTCACTGAAGATCTGGGC
TCCAGCTTTGAACCATACTGGTTCTTTGAAGTCCACTTTTACCCATTTTTCAAGAACTTCTGGTGTAATGCAACCAAAAGCTCCAAGCATGGCCC
ATCTCCCATGGATAACCTCAAGAGCTCTGTTCTTAGCAAAGGCCTCGGGATCAGCAGATAAACCAGCAGTATCCCATCCGTAATCACCAGGGAAT
TCTCCAGTCAAGTATGAAGGAGTTTGAGCAGAAAATGGTCCCAAGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E1239870] SGN-U579843 Tomato 200607 Build 2 157 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T969962 [Download][View] Facility Assigned ID: CK714848
Submitter: None Sequencing Facility:
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: