Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E1239922

Search information 
Request: 1239922Match: SGN-E1239922
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C1009629Clone name: CT143
nocartOrdering Not Available
Library Name: Sl_LeafCherry01Organism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: epidermis
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C1009629 [CT143] Trace: SGN-T968717 EST: SGN-E1237297 Direction: Unknown Facility: Unknown
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E1239922Length: 444 bp (444 bp untrimmed)
Status: Current VersionDirection: Unknown
>SGN-E1239922 [] (trimmed) ATGGGCATTGATCTCAAATTTTTCTTTGTTAGAGCTGGTATGATGGGATGGTTACTTATCAATCTTTCAGTTCTTGCAAAATGTGTTATAGAGGC
TAAATTGAGCCAATCAATGATTCTCTACCAGCTATTTTGTGGGCTCTACATCCTTGACTACTTCTTCTATGAAGAGTTCATGACCTCCACATGGG
ATATAATAGCAGAGAGGTTGGGCTACATGCTGGTTTTTGGTGATCTAGTCTTTATACCGTTCACCTTCAGTATTCAGGGTTGGTGGCTTTTGAGT
AACAAAGTGGAGCTAACAACAGCAGCAATAATTGCCAATTGCCTCGTCTTTCTTATTGGGTACTCGGTGTTCAGAGGAGCCAATAAGCAGAAGCA
TGTATTTAAAAAGGATCCCAAGGCACCCATATGGGGTAGTCCTCCAAAAGTTATTGGGGGAAAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E1239922] SGN-U582281 Tomato 200607 Build 2 19 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T970016 [Download][View] Facility Assigned ID: AA824853
Submitter: None Sequencing Facility:
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: