EST details — SGN-E1241756
| Search information |
| Request: 1241756 | Match: SGN-E1241756 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C977261 | Clone name: LECAD02E23 |
| ||
| Library Name: LeCAD | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Seedling
Development Stage: Two-week-old seedings
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
No additional reads found.[Show information hierarchy]
| Sequence |
| Sequence Id: SGN-E1241756 | Length: 206 bp (206 bp untrimmed) |
| Status: Current Version | Direction: Unknown |
>SGN-E1241756 [] (trimmed)
ACTTAACACGGTCAGGACCATACCATGGGCTACCAGAGGAGGCTGGCTTGGCCTTGGTAGCAGTTTTCCTCATGGTGACTCTCCCATTTCCGGTG
ATTTCAGAAGAAGATGGGGAGAGTTTAACCGCCTTTCCGGCAAATGTAGAGGAAGAAAGAGCCATGGTAGAAGTAGCCATTATAGAAGTAGAATG
AGAAACTCTTGAATGT
ATTTCAGAAGAAGATGGGGAGAGTTTAACCGCCTTTCCGGCAAATGTAGAGGAAGAAAGAGCCATGGTAGAAGTAGCCATTATAGAAGTAGAATG
AGAAACTCTTGAATGT
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E1241756] | SGN-U579181 | Tomato 200607 | Build 2 | 140 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T971880 [Download][View] | Facility Assigned ID: CK715016 |
| Submitter: None | Sequencing Facility: |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.000 | Expected Error Rate: 0.0000 | Quality Trim Threshold: |
Working
